Sequence ID | >W1910912274 |
Genome ID | NHPD01000034 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halorubrum ezzemoulense Ec15 [NHPD] |
Start position on genome | 38910 |
End posion on genome | 38840 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gtaggagtac |
tRNA gene sequence |
GGGACCGTGGGTTAGTGGTATACTCCGAGCCTTGGGTGCTCGTGACCCCGGTTCGAATCC |
Downstream region at tRNA end position |
tgccgctgcg |
Secondary structure (Cloverleaf model) | >W1910912274 Pro TGG c Attc tgccgctgcg G - C G - C G - C A - T C - G C - G G - C T A T G G G C C A G A G | | | | | G T T T G G C C C G G C G | | + T T G T A C T T A C TGAC C - G G - C A - T G - C C - G C T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |