Sequence ID | >W1910928144 |
Genome ID | NIQI01000002 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Campylobacter hyointestinalis subsp. hyointestinalis S1559c [NIQI] |
Start position on genome | 181916 |
End posion on genome | 181829 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ttacttcact |
tRNA gene sequence |
CGGGAGATGGCTGAGTGGTCGAAAGCGGCGGTCTTGAAAACCGTTGAGGTGAAAGCCTCC |
Downstream region at tRNA end position |
cttattttag |
Secondary structure (Cloverleaf model) | >W1910928144 Ser TGA t GCCA cttattttag C - G G - C G - C G - C A - T G - C A - T T A T T T C C C A T G A G | + | | | G G G T C G A G G G G C G | | | T T T A A G C C G A G TGAGGTGAAAGCCTCC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |