Sequence ID | >W1910928905 |
Genome ID | NIRL01000001 |
Search identical group | |
Phylum/Class | Fusobacteriota |
Species | Fusobacterium polymorphum [NIRL] |
Start position on genome | 748152 |
End posion on genome | 748065 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aaatataaat |
tRNA gene sequence |
GCCTGGATGGCGGAATAGGTAGACGCACAGGACTTAAAATCCTGTGGTACTTAGTACCGT |
Downstream region at tRNA end position |
tttatatcgc |
Secondary structure (Cloverleaf model) | >W1910928905 Leu TAA t ACCA tttatatcgc G - C C - G C - G T - A G + T G - C A - T T T T C G G C C A T A A G | | | | | G A G G C G G C C G G C G | | | T T G A C G C T A G A TGGTACTTAGTACCGT C - G A - T G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |