Sequence ID | >W1910943243 |
Genome ID | NJHU01000013 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Cylindrospermopsis raciborskii C03 [NJHU] |
Start position on genome | 168195 |
End posion on genome | 168277 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aggcaaccgT |
tRNA gene sequence |
GCGGATGTGGCGGAATTGGTATACGCGCACGCTTGAGGTGCGTGTGGCATTGCCTTGCGA |
Downstream region at tRNA end position |
tgccctgtta |
Secondary structure (Cloverleaf model) | >W1910943243 Leu GAG T ATaa tgccctgtta G - C C - G G - C G - C A - T T - A G - C T G T C G C T C A T A A G | | | | | G T G G C G G C G A G C G | | | T T G A C G C T A T G TGGCATTGCCTT C - G A - T C - G G - C C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |