Sequence ID | >W1911140633 |
Genome ID | NOYV01000012 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Rhodococcus sp. 05-340-1 [NOYV] |
Start position on genome | 200878 |
End posion on genome | 200951 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
tgaagttcct |
tRNA gene sequence |
GGCCCCGTCGTCTAGCGGCCTAGGACGCCGCCCTCTCAAGGCGGTAGCGCGGGTTCGAAT |
Downstream region at tRNA end position |
ctgacaacac |
Secondary structure (Cloverleaf model) | >W1911140633 Glu CTC t ACaa ctgacaacac G + T G - C C - G C - G C - G C - G G - C T A T T G C C C A C G A C + | | | | G G T C T G G C G G G C G + | | | T T C G G A C C T A G TAGC C - G C - G G - C C - G C - G C A T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |