Sequence ID | >W1911155345 |
Genome ID | NPJY01000001 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Caldicellulosiruptor bescii RKCB122 [NPJY] |
Start position on genome | 2860870 |
End posion on genome | 2860795 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ttattgaggt |
tRNA gene sequence |
GGGGATGTAGCTCAGTTGGGAGAGCACCTGCCTTGCAAGCAGGGGGTCAGGAGTTCGAAT |
Downstream region at tRNA end position |
atgatatatg |
Secondary structure (Cloverleaf model) | >W1911155345 Ala TGC t ACCA atgatatatg G - C G - C G + T G - C A - T T - A G - C T A T T C C T C A T G A A | | | | | G T C T C G A G G A G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |