Sequence ID | >W1911155456 |
Genome ID | NPKA01000001 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Burkholderia sp. CF145 [NPKA] |
Start position on genome | 2614133 |
End posion on genome | 2614057 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aagttagtgt |
tRNA gene sequence |
AGGGGAGTCGCCAAGTTGGTTAAGGCACCGGATTTTGATTCCGGCATTCGAGGGTTCGAG |
Downstream region at tRNA end position |
aaatttctcg |
Secondary structure (Cloverleaf model) | >W1911155456 Gln TTG t GCCA aaatttctcg A - T G - C G - C G - C G - C A - T G - C T G T C T T C C A T G A C | | + | | G T A C C G G A G G G C G | | | T T G A G G C T T A A CATTC C - G C - G G - C G - C A - T T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |