Sequence ID | >W1911162458 |
Genome ID | NPOU01000001 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Streptococcus sobrinus KCOM 1157 [NPOU] |
Start position on genome | 398016 |
End posion on genome | 398089 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
acgttaatgT |
tRNA gene sequence |
GTCTCCTTAGTTAAATGGATATAACAACTCCCTCCTAAGGAGTAGTTGCTGGTTCGATTC |
Downstream region at tRNA end position |
ttttaatgct |
Secondary structure (Cloverleaf model) | >W1911162458 Arg CCT T ATga ttttaatgct G + T T - A C - G T + G C - G C - G T - A T T T C G G C C A T A A A | | + | | G G A T T G G C T G G C G | | | | T T A T A A C T A A AGTT A - T C - G T - A C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |