Sequence ID | >W1911200237 |
Genome ID | NREO01000021 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Arcobacter suis CECT7833 [NREO] |
Start position on genome | 2389 |
End posion on genome | 2313 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cgccattaat |
tRNA gene sequence |
GGGTTATTAGCTCAGCTGGTTAGAGCACTCGGCTCATAACCGAGTGGTCGAAGGTTCGAG |
Downstream region at tRNA end position |
ctattttaat |
Secondary structure (Cloverleaf model) | >W1911200237 Met CAT t ACCA ctattttaat G - C G - C G - C T - A T - A A - T T - A T G T C T T C C A C G A A | | | | | G T C T C G G A A G G C G | | | | T T G G A G C T T A A TGGTC C - G T - A C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |