Sequence ID | >W1911239239 |
Genome ID | NSDI01000003 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Capnocytophaga canis 17-158 [NSDI] |
Start position on genome | 167017 |
End posion on genome | 167099 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ccgcatttgg |
tRNA gene sequence |
GGGAAGATACTCAAGCGGCCAACGAGGGCAGACTGTAAATCTGCTGACTATGTCTTCGCA |
Downstream region at tRNA end position |
aaagagattt |
Secondary structure (Cloverleaf model) | >W1911239239 Tyr GTA g ACta aaagagattt G - C G - C G - C A - T A - T G - C A - T T A T C G T C C A C G A A | | | | | G G A C T C G C A G G C G | | | T T C C G A G C A A G TGACTATGTCTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |