Sequence ID | >W1911239450 |
Genome ID | NSDR01000041 |
Phylum/Class | Alphaproteobacteria |
Species | Wolbachia endosymbiont of Drosophila ananassae of Drosophila ananassae wAna_India [NSDR] |
Start position on genome | 8216 |
End posion on genome | 8290 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gtatacagtt |
tRNA gene sequence |
GGCCTGATAGCTCAGTTGGTAGAGCAAAGGACTGAAAATCCTTGTGTCGCTGGTTCGATT |
Downstream region at tRNA end position |
tctctttctt |
Secondary structure (Cloverleaf model) | >W1911239450 Phe GAA t ACCt tctctttctt G - C G - C C - G C - G T - A G - C A - T T T T C G T C C A T G A A | | | | G T C T C G G C T G G C G | | | | T T G G A G C T A A GTGTC A - T A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |