Sequence ID | >W1911239515 |
Genome ID | NSDT01000011 |
Phylum/Class | Alphaproteobacteria |
Species | Wolbachia endosymbiont of Drosophila ananassae of Drosophila ananassae wAna_Indonesia [NSDT] |
Start position on genome | 6759 |
End posion on genome | 6836 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
ctttgtgaaa |
tRNA gene sequence |
GCACCCTTAGCTCAGTTGGATTAGAGCATTTGACTACGGATCAAAAGGTCGGGCGTTCAA |
Downstream region at tRNA end position |
cattttatag |
Secondary structure (Cloverleaf model) | >W1911239515 Arg ACG a ACCA cattttatag G - C C - G A - T C - G C - G C - G T - A T G T C T C G C A T T G A A | + | | | A G C T C G G G G C G C G | | | | T T A G A G C T T A A AGGTC T - A T - A T - A G - C A - T C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |