Sequence ID | >W1911242240 |
Genome ID | NSFP01000002 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Mesorhizobium loti R7ANSxAA22 [NSFP] |
Start position on genome | 493237 |
End posion on genome | 493163 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
cgccgtgtga |
tRNA gene sequence |
GCGGGTGTAGCTCAGGGGTAGAGCACAACCTTGCCAAGGTTGGGGTCGAGCGTTCGAATC |
Downstream region at tRNA end position |
atttcctcca |
Secondary structure (Cloverleaf model) | >W1911242240 Gly GCC a TCCA atttcctcca G - C C - G G - C G - C G - C T - A G - C T A T T T C G C A G A A + | | | | G G C T C G G A G C G C G | | | | T T G G A G C T A A GGGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |