Sequence ID | >W1911244263 |
Genome ID | NSHF01000092 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Nostoc sp. 'Peltigera malacea cyanobiont' DB3992 [NSHF] |
Start position on genome | 6817 |
End posion on genome | 6899 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gacaaatcaT |
tRNA gene sequence |
GCGGATGTGGCGGAATTGGTATACGCGCACGCTTGAGGTGCGTGTGGCTTTGCCTTGGGA |
Downstream region at tRNA end position |
ttgcttgttt |
Secondary structure (Cloverleaf model) | >W1911244263 Leu GAG T ATtt ttgcttgttt G - C C - G G - C G - C A - T T - A G - C T G T C C C T C A T A A G | | | | | G T G G C G G G G A G C G | | | T T G A C G C T A T G TGGCTTTGCCTT C - G A - T C - G G - C C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |