Sequence ID | >W1911245386 |
Genome ID | NSKA01000004 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Halomonas humidisoli WN018 [NSKA] |
Start position on genome | 439939 |
End posion on genome | 439864 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
cgtgaccagc |
tRNA gene sequence |
GGGTGGTTAGCTCAGTTGGGAGAGCACCAGCCTTACAAGCTGGGGGTCACTGGTTCGAAC |
Downstream region at tRNA end position |
tttatttggt |
Secondary structure (Cloverleaf model) | >W1911245386 Val TAC c ACCA tttatttggt G - C G - C G - C T - A G - C G - C T - A C A T T G A C C A T G A A | | | | | G T C T C G A C T G G C G | | | | T T G G A G C G A A GGGTC C - G C - G A - T G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |