Sequence ID | >W1911247899 |
Genome ID | NSLX01000023 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Porphyromonas gingivalis WW2096 [NSLX] |
Start position on genome | 12131 |
End posion on genome | 12058 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
gatgggtatt |
tRNA gene sequence |
GACTCCGTAGCTCAGTTGGTAGAGCAAATGACTCTTAATCATTGGGTCGTGAGTTCGAGC |
Downstream region at tRNA end position |
atcaatagca |
Secondary structure (Cloverleaf model) | >W1911247899 Lys CTT t ACaa atcaatagca G - C A - T C - G T + G C - G C - G G - C C G T C A C T C A T G A A | | | | | G T C T C G G T G A G C G | | | | T T G G A G C T A A GGGTC A - T A - T T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |