Sequence ID | >W1911260406 |
Genome ID | NSUL01000002 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas aeruginosa CND03 [NSUL] |
Start position on genome | 90962 |
End posion on genome | 91037 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
cgagagtgaa |
tRNA gene sequence |
GGGTGATTAGCTCAGCTGGGAGAGCATCTGCCTTACAAGCAGAGGGTCGGCGGTTCGATC |
Downstream region at tRNA end position |
atctcgcaag |
Secondary structure (Cloverleaf model) | >W1911260406 Val TAC a ACCA atctcgcaag G - C G - C G - C T - A G - C A - T T - A C T T C T G C C A C G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C G A A GGGTC T - A C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |