Sequence ID | >CHL090100598 |
Genome ID | AJ879453 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Acorus calamus |
Start position on genome | 107360 |
End posion on genome | 107434 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
agacggggtg |
tRNA gene sequence |
GGGCCTGTAGCTCAGAGGATTAGAGCACGTGGCTACGAACCACGGTGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
ccggtccaaa |
Secondary structure (Cloverleaf model) | >CHL090100598 Arg ACG g ACaa ccggtccaaa G - C G - C G - C C - G C C T T G - C T A T C T C C C A A G A A | + | | | G G C T C G G G G G G C G | | | | T T A G A G C T T A A GTGTC C - G G - C T - A G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |