Sequence ID | >W1911269416 |
Genome ID | NTAP01000017 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas aeruginosa PA-W25 [NTAP] |
Start position on genome | 99892 |
End posion on genome | 99967 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
cagccaataa |
tRNA gene sequence |
GCCGGTATGGCGCAACAGGGAGCGCTGCTGATTTGTAATCAGAGGGTTGCGGGTTCGACT |
Downstream region at tRNA end position |
cactacaagg |
Secondary structure (Cloverleaf model) | >W1911269416 Thr TGT a ACCA cactacaagg G - C C - G C - G G - C G - C T + G A - T T C T C G T C C A C A A G | | + | | G A C G C G G C G G G C G | | | | T T G G C G C G A T GGGTT G A C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |