Sequence ID | >W1911281112 |
Genome ID | NTHL01000062 |
Phylum/Class | Alphaproteobacteria |
Species | Wolbachia endosymbiont of Drosophila subpulchrella of Drosophila subpulchrella wSpc [NTHL] |
Start position on genome | 13027 |
End posion on genome | 12955 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aacggtttat |
tRNA gene sequence |
TCCTCGGTAGCTCAGTGGTAGAGCAGTTGGCTGTTAACCAATTGGTCGCTGGTTCGAATC |
Downstream region at tRNA end position |
ttctctgttg |
Secondary structure (Cloverleaf model) | >W1911281112 Asn GTT t GCtc ttctctgttg T - A C - G C - G T + G C - G G - C G - C T A T C G G C C A G A A | | + | | G T C T C G G C T G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |