Sequence ID | >W1911281120 |
Genome ID | NTHL01000078 |
Phylum/Class | Alphaproteobacteria |
Species | Wolbachia endosymbiont of Drosophila subpulchrella of Drosophila subpulchrella wSpc [NTHL] |
Start position on genome | 10574 |
End posion on genome | 10501 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
aaaccacgat |
tRNA gene sequence |
GGGTAATTAGCTCAGTTGGTAGAGCACTTGCTTGACGTGCAAGCGGTCGCTGGTTCGAAC |
Downstream region at tRNA end position |
ttttgttcat |
Secondary structure (Cloverleaf model) | >W1911281120 Val GAC t ACgt ttttgttcat G - C G - C G - C T - A A - T A - T T + G C A T T G A C C A T G A A + | | | | G T C T C G G C T G G C G | | | | T T G G A G C T A A CGGTC C - G T - A T - A G - C C - G T T T G G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |