Sequence ID | >W1911332760 |
Genome ID | NUMY01000001 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Bacillus cereus AFS038126 [NUMY] |
Start position on genome | 881 |
End posion on genome | 955 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
catatattat |
tRNA gene sequence |
TCCGCAGTAGCTCAGTGGTAGAGCTATCGGCTGTTAACCGATCGGTCGTAGGTTCGAGTC |
Downstream region at tRNA end position |
tggcccgttg |
Secondary structure (Cloverleaf model) | >W1911332760 Asn GTT t GCCA tggcccgttg T - A C - G C - G G - C C - G A - T G - C T G T C A T C C A G A A | | | | | G T C T C G G T A G G C G | | | | T T G G A G C T A T CGGTC A - T T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |