| Sequence ID | >CHL090101737 |
| Genome ID | AY958086 |
| Phylum/Class | Viridiplantae |
| Species | Zygnema circumcarinatum |
| Start position on genome | 29161 |
| End posion on genome | 29247 |
| Amino Acid | Ser |
| Anticodon | CGA |
| Upstream region at tRNA start position |
gtctttacaa |
| tRNA gene sequence |
GGATAAATGGCAGAGTGGATGATTGCGACGGCTTCGAAAGCCGTTTTAGCCTTTTGCTAA |
| Downstream region at tRNA end position |
cgtttgtcac |
| Secondary structure (Cloverleaf model) | >CHL090101737 Ser CGA
a GCtt cgtttgtcac
G - C
G - C
A - T
T T
A - T
A - T
A - T T A
T C T C C C A
T G A G | | | | | G
G G A C G G A G G G C
G + | | | T T
A T T G C
T G A G TTTAGCCTTTTGCTAAC
A - T
C - G
G - C
G - C
C - G
T A
T A
C G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |