| Sequence ID | >CHL090102350 |
| Genome ID | DQ821119 |
| Phylum/Class | Viridiplantae |
| Species | Angiopteris evecta |
| Start position on genome | 16262 |
| End posion on genome | 16346 |
| Amino Acid | Ser |
| Anticodon | CGA |
| Upstream region at tRNA start position |
aggatcctta |
| tRNA gene sequence |
GGAGAAATGGCAGAGTGGTCTATTGTGACGATCTCGAAAATCGTTTTAGCTCCGGTTAAC |
| Downstream region at tRNA end position |
gactccattt |
| Secondary structure (Cloverleaf model) | >CHL090102350 Ser CGA
a Attc gactccattt
G - C
G - C
A - T
G - C
A - T
A - T
A - T T A
T C T C C C A
T G A G | | | | | G
G G A C G G A G G G C
G + | | + T T
T T T G T
C T A G TTTAGCTCCGGTTAAC
A - T
C - G
G - C
A - T
T - A
C A
T A
C G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |