Sequence ID | >W1911480756 |
Genome ID | OAFP01000019 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Neisseria meningitidis [OAFP] |
Start position on genome | 2337 |
End posion on genome | 2248 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tttcacaaat |
tRNA gene sequence |
GCCCGGGTGGTGAAATAGGTAGACACAACGGACTTAAAATCCGTCGGGACTAAACATCCC |
Downstream region at tRNA end position |
agctgaaaat |
Secondary structure (Cloverleaf model) | >W1911480756 Leu TAA t ACCA agctgaaaat G - C C - G C - G C - G G - C G - C G + T T T T C G G C C A T A A G | | | | | G A A G T G G C C G G C G | | | T T G A C A C T A G A CGGGACTAAACATCCCGT A - T C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |