Sequence ID | >W1911494253 |
Genome ID | OBKE01000209 |
Search identical group | |
Phylum/Class | Unclassified |
Species | bacterium [OBKE] |
Start position on genome | 3338 |
End posion on genome | 3414 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gctccttcat |
tRNA gene sequence |
GGCTGGGTAGCTCAGGTGGTTAGAGCGAGGGTCTCATAATCCCTAGGTCGGCAGTTCGAG |
Downstream region at tRNA end position |
ctcaatacac |
Secondary structure (Cloverleaf model) | >W1911494253 Met CAT t ACCA ctcaatacac G - C G - C C - G T - A G - C G - C G + T T G T C C G T C A G G A A | | | | | G T C T C G G G C A G C G | | | | T T G G A G C T T A G AGGTC A - T G - C G - C G - C T T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |