Sequence ID | >W1911494843 |
Genome ID | OBMJ01000001 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Streptomyces sp. 1331.2 [OBMJ] |
Start position on genome | 3641715 |
End posion on genome | 3641639 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
agtgcggcaa |
tRNA gene sequence |
GGGCCTATAGCTCAGACGGTTAGAGCGCTTCCCTGATAAGGAAGAGGCCACAGGTTCAAG |
Downstream region at tRNA end position |
ccgcgaaggc |
Secondary structure (Cloverleaf model) | >W1911494843 Ile GAT a ACCA ccgcgaaggc G - C G - C G - C C - G C - G T - A A - T T G T T G T C C A A G A A | | | | | A C C T C G A C A G G C G | | | | T T G G A G C T T A G AGGCC C - G T - A T - A C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |