Sequence ID | >W1911519477 |
Genome ID | OFTM01000028 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Cupriavidus taiwanensis [OFTM] |
Start position on genome | 149933 |
End posion on genome | 149858 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ggaacatgtt |
tRNA gene sequence |
GCCGAAGTAGCTCAGTCGGTAGAGCAGCTCATTCGTAATGAGAAGGTCGGGGGTTCGATT |
Downstream region at tRNA end position |
aagccaatat |
Secondary structure (Cloverleaf model) | >W1911519477 Thr CGT t ACCA aagccaatat G - C C - G C - G G - C A - T A - T G - C T T T T C T C C A T G A A + | + | | G C C T C G G G G G G C G | | | | T T G G A G C T A A AGGTC G A C - G T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |