Sequence ID | >CHL090103181 |
Genome ID | U38804 |
Search identical group | |
Phylum/Class | Rhodophyta |
Species | Porphyra purpurea |
Start position on genome | 34372 |
End posion on genome | 34284 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tttaagtaaT |
tRNA gene sequence |
GCATCTGTGGCCGAGGGGCCGAAGGCAGCGGACTCATAATCCGCCATTTCGAAAGAGACG |
Downstream region at tRNA end position |
aatagatctc |
Secondary structure (Cloverleaf model) | >CHL090103181 Met CAT T ATtt aatagatctc G - C C - G A - T T - A C - G T - A G - C T A T C G A C C A G G A G | | | | | G G G C C G G C T G G C G | | | T T C A G G C C G A A CATTTCGAAAGAGACGTC G - C C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |