Sequence ID | >CHL090103207 |
Genome ID | U87145 |
Search identical group | |
Phylum/Class | Alveolata |
Species | Toxoplasma gondii |
Start position on genome | 2165 |
End posion on genome | 2093 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ataaaataaa |
tRNA gene sequence |
AGGTCTATCGTCTAATGGGTAAGGACAAAAACCTTCTAAGGTTTTTATGTAGGTTCGAAA |
Downstream region at tRNA end position |
aagattagta |
Secondary structure (Cloverleaf model) | >CHL090103207 Arg TCT a Aact aagattagta A - T G - C G - C T + G C - G T - A A - T A A T C A T C C A T A A C | | | | | G G T C T G G T A G G C G + | | | T T G G G A C T A A A TTAT A - T A - T A - T A G C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |