Sequence ID | >W1911532480 |
Genome ID | OGVC01000014 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Latilactobacillus fuchuensis MFPC41A2801 [OGVC] |
Start position on genome | 41626 |
End posion on genome | 41539 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ataccattgt |
tRNA gene sequence |
GGAGAGTTGGCAGAGTGGTAATGCAACGGACTCGAAATCCGTCGAACCGGCTTATACCGG |
Downstream region at tRNA end position |
gctatctaaa |
Secondary structure (Cloverleaf model) | >W1911532480 Ser CGA t Ttca gctatctaaa G - C G - C A - T G - C A - T G - C T - A T T T T G T C C A G A G + | | | | A T G A C G G C A G G C G | | | T T G A T G C T A A CGAACCGGCTTATACCGGCGC A - T C - G G - C G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |