Sequence ID | >W1911533080 |
Genome ID | OKQL01000045 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanobrevibacter oralis M2 CSUR P5920 [OKQL] |
Start position on genome | 619 |
End posion on genome | 704 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
attttatatT |
tRNA gene sequence |
GTCGGGATGGCCCAGCCTGGTACGGCGTCGGACTGCTAATCCGATGATCTTATGATCACA |
Downstream region at tRNA end position |
tttatttatc |
Secondary structure (Cloverleaf model) | >W1911533080 Ser GCT T GTtt tttatttatc G - C T + G C - G G - C G - C G - C A - T T A T T G C C C A C G A G | | | | | A C C C C G A C G G G C T | | | T T G C G G C G T A G TGATCTTATGATCAC T - A C - G G - C G - C A - T C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |