| Sequence ID | >W1911533946 |
| Genome ID | OKRL01000001 |
| Phylum/Class | Bacillota |
| Species | Leuconostoc mesenteroides CECT 9217 [OKRL] |
| Start position on genome | 1128524 |
| End posion on genome | 1128451 |
| Amino Acid | Arg |
| Anticodon | TCT |
| Upstream region at tRNA start position |
attatagtac |
| tRNA gene sequence |
GCGCTGGTAGCTCAGCTGGATAGAGCAGCCGGTTTCTACCCGGCAGGTCGAGGGTTCGAA |
| Downstream region at tRNA end position |
acaacgtttt |
| Secondary structure (Cloverleaf model) | >W1911533946 Arg TCT
c Attt acaacgtttt
G - C
C - G
G - C
C - G
T - A
G - C
G + T T A
T C C C C C A
C G A A | | | | G
T C T C G G A G G G C
G | | | | T T
G G A G C
A T A A AGGTC
G - C
C - G
C - G
G - C
G - C
T C
T A
T C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |