Sequence ID | >W1911543248 |
Genome ID | ORYW01000178 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Xanthomonas fragariae ICMP 6278 [ORYW] |
Start position on genome | 2433 |
End posion on genome | 2525 |
Amino Acid | Ile |
Anticodon | TAT |
Upstream region at tRNA start position |
aaccgatcac |
tRNA gene sequence |
GCCCCTGTAGCTCAATTGGTAGAGCAGCGGATTTATATCCCGTCAGCGCCAGATAAGCGG |
Downstream region at tRNA end position |
ccattgcatg |
Secondary structure (Cloverleaf model) | >W1911543248 Ile TAT c ACCA ccattgcatg G - C C - G C - G C - G C - G T - A G - C C T T C G G C C A T A A A | | | | | G T C T C G G C C G G C G | | | | T T G G A G C T A A CAGCGCCAGATAAGCGGCAAGT G + T C - G G - C G - C A C T T T A T A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |