Sequence ID | >W1911545083 |
Genome ID | OUND01000001 |
Phylum/Class | Gammaproteobacteria |
Species | Arsenophonus endosymbiont of Aleurodicus floccissimus of Aleurodicus floccissimus ARAF [OUND] |
Start position on genome | 464721 |
End posion on genome | 464632 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aatgataacc |
tRNA gene sequence |
GGTGAGGTGTCCGAGTGGCTGAAGGAGCACGCCTGGAAAGTGTGTATACGTGAAAACGTA |
Downstream region at tRNA end position |
tataaaatat |
Secondary structure (Cloverleaf model) | >W1911545083 Ser GGA c GCCA tataaaatat G - C G - C T - A G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G C C T G A G G G C G | | | T T C A G G A T G A G TATACGTGAAAACGTATC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |