Sequence ID | >W1911545102 |
Genome ID | OUND01000005 |
Phylum/Class | Gammaproteobacteria |
Species | Arsenophonus endosymbiont of Aleurodicus floccissimus of Aleurodicus floccissimus ARAF [OUND] |
Start position on genome | 188809 |
End posion on genome | 188734 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
acgccctgtt |
tRNA gene sequence |
GCCCGGATAGCTCAGTCGGTAGAGCAGAGGATTGAAAATCCTCGTGTCGGTGGTTCGATT |
Downstream region at tRNA end position |
tgatttcaag |
Secondary structure (Cloverleaf model) | >W1911545102 Phe GAA t ACCA tgatttcaag G - C C - G C - G C - G G - C G - C A - T T T T C C G C C A T G A A | | + | | G C C T C G G G T G G C G | | | | T T G G A G C T A A GTGTC G - C A - T G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |