Sequence ID | >W1911545151 |
Genome ID | OUNF01000214 |
Phylum/Class | Alphaproteobacteria |
Species | Wolbachia endosymbiont of Aleurodicus floccissimus WBAF (OUNF) of Aleurodicus floccissimus WBAF [OUNF] |
Start position on genome | 1748 |
End posion on genome | 1831 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
attaaaatag |
tRNA gene sequence |
GCCCCTGTGGTGGAATGGTAGACACGGCAGACTCAAAATCTGTTGCTTGCAAGAGCATGC |
Downstream region at tRNA end position |
aaacattgga |
Secondary structure (Cloverleaf model) | >W1911545151 Leu CAA g ACtc aaacattgga G - C C - G C - G C - G C - G T - A G - C T G T C G G C C A T A A G | | + | | A G G G T G G C T G G C G | | | T T T A C A C A G G TGCTTGCAAGAGCAT G + T C - G A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |