| Sequence ID | >CHL090200084 |
| Genome ID | AY958086 |
| Phylum/Class | Viridiplantae |
| Species | Zygnema circumcarinatum |
| Start position on genome | 30776 |
| End posion on genome | 30704 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
tatatcttta |
| tRNA gene sequence |
GCCCCCATCGTCTAGAGGCCTAGGACACCTCCCTTTCACGGAGGCGACGGGGATTCGAAT |
| Downstream region at tRNA end position |
agtgagtaat |
| Secondary structure (Cloverleaf model) | >CHL090200084 Glu TTC
a Atat agtgagtaat
G + T
C - G
C - G
C - G
C - G
C - G
A - T T A
T C C C C T A
A G A C | | | | | G
G T C T G G G G G A C
G + | | | T T
C G G A C
C T A A CGAC
C - G
C - G
T - A
C - G
C - G
C C
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |