Sequence ID | >W1911568541 |
Genome ID | PCQI01000001 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas sp. MYb13 [PCQI] |
Start position on genome | 692522 |
End posion on genome | 692446 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
acctgttaca |
tRNA gene sequence |
GGGCCTATAGCTCAGTTGGTCAGAGCAGAGGACTCATAATCCTTTGGTCCACGGTTCAAG |
Downstream region at tRNA end position |
aacaagaaag |
Secondary structure (Cloverleaf model) | >W1911568541 Met CAT a ACCA aacaagaaag G - C G - C G - C C - G C - G T + G A - T T G T G T G C C A T G A A | | | | | A T C T C G C A C G G C G | | | | T T G G A G C T C A A TGGTC G + T A - T G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |