Sequence ID | >W1911584746 |
Genome ID | PIPJ01000008 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Aliidiomarina iranensis GBPy7 [PIPJ] |
Start position on genome | 52443 |
End posion on genome | 52519 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
caatatcaat |
tRNA gene sequence |
TCCCCAGTAGCTCAGTTGGTTAGAGCGGTGGACTGTTAATCCATGTGTCGTTGGTTCGAA |
Downstream region at tRNA end position |
ttgagcgcca |
Secondary structure (Cloverleaf model) | >W1911584746 Asn GTT t GCCA ttgagcgcca T - A C - G C - G C - G C - G A - T G - C T A T C A A C C A T G A A | | | | | G T C T C G G T T G G C G | | | | T T G G A G C T T A G GTGTC G + T T - A G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |