Sequence ID | >W1911586425 |
Genome ID | PIZV01000077 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Chryseobacterium sp. PMSZPI [PIZV] |
Start position on genome | 77334 |
End posion on genome | 77408 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
accaccaaaa |
tRNA gene sequence |
GGCGAGGTAGCTCAGTTGGTTAGAGCGCAGGATTCATAACCCTGAGGTCACGGGTTCAAT |
Downstream region at tRNA end position |
tagaaggaaa |
Secondary structure (Cloverleaf model) | >W1911586425 Met CAT a ACaa tagaaggaaa G + T G - C C - G G - C A - T G + T G - C T T T T G C C C A T G A A | | | | | A T C T C G A C G G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T G - C G - C A C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |