Sequence ID | >W1911596820 |
Genome ID | PNHL01000005 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Brachybacterium sp. UMB0905 [PNHL] |
Start position on genome | 28223 |
End posion on genome | 28151 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
cggacgcagc |
tRNA gene sequence |
GGGCGATTGGCGCAGCGGTAGCGCGCTTCCCTGACACGGAAGAGGTCACTGGTTCGATCC |
Downstream region at tRNA end position |
cctgaacggc |
Secondary structure (Cloverleaf model) | >W1911596820 Val GAC c ACgc cctgaacggc G - C G - C G - C C - G G - C A - T T - A C T T T G A C C A G A G | | | | | G C C G C G A C T G G C G | | | | T T G G C G C T A G AGGTC C - G T - A T - A C - G C - G C C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |