Sequence ID | >W1911621953 |
Genome ID | PQNO01000086 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium bovis 17-0240 - LARGE [PQNO] |
Start position on genome | 4431 |
End posion on genome | 4359 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
gtacaacgat |
tRNA gene sequence |
TGGCCTATGGTGTAATTGGCAACACAACGGTTTCTGGTACCGTCATTCTAGGTTCGAGTC |
Downstream region at tRNA end position |
atatcaccgg |
Secondary structure (Cloverleaf model) | >W1911621953 Gln CTG t GCgg atatcaccgg T - A G - C G - C C - G C - G T - A A - T T G T G G T C C A T A A G | + | | | G T T G T G C T A G G C G | | | | T T G A C A C C A A CATT A - T C - G G - C G - C T - A T T T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |