| Sequence ID | >W1911625939 |
| Genome ID | PQZQ01000001 |
| Phylum/Class | Campylobacterota |
| Species | Campylobacter jejuni CB387 [PQZQ] |
| Start position on genome | 621547 |
| End posion on genome | 621462 |
| Amino Acid | Leu |
| Anticodon | GAG |
| Upstream region at tRNA start position |
ctttttttat |
| tRNA gene sequence |
GCGGTTATGGTGGAATTGGTAGACACGCCATCTTGAGGGGGTGGTGCGCTCCGCGTGTGC |
| Downstream region at tRNA end position |
ttatttaaaa |
| Secondary structure (Cloverleaf model) | >W1911625939 Leu GAG
t ACCA ttatttaaaa
G - C
C - G
G - C
G - C
T - A
T - A
A - T T A
T C G C T C A
T A A G | | | | | A
T G G T G G C G A G C
G | | | T T
G A C A C
T A G G TGCGCTCCGCGTGT
C - G
C - G
A - T
T + G
C - G
T G
T G
G A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |