| Sequence ID | >W1911628703 |
| Genome ID | PRCK01000001 |
| Phylum/Class | Campylobacterota |
| Species | Campylobacter jejuni CB296 [PRCK] |
| Start position on genome | 378303 |
| End posion on genome | 378379 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
caacttaggc |
| tRNA gene sequence |
GGATTTATAGCTCAGTTGGTTAGAGCAACCGGCTCATAACCGGTTGGTCGCAGGTTCGAG |
| Downstream region at tRNA end position |
ttgctctttt |
| Secondary structure (Cloverleaf model) | >W1911628703 Met CAT
c ACCA ttgctctttt
G - C
G - C
A - T
T - A
T - A
T - A
A - T T G
T C G T C C A
T G A A | | | | | G
T C T C G G C A G G C
G | | | | T T
G G A G C
T T A A TGGTC
A - T
C - G
C - G
G - C
G - C
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |