Sequence ID | >W1911629848 |
Genome ID | PSYU01000001 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Haloferax sp. Atlit-19N [PSYU] |
Start position on genome | 128249 |
End posion on genome | 128334 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cgaccgaagt |
tRNA gene sequence |
GTTGCGGTAGCCAAGCCTGGCCCAAGGCGCTGGGTTGCTAACTCAGTGGCGTCAAGCCCC |
Downstream region at tRNA end position |
acaacacgac |
Secondary structure (Cloverleaf model) | >W1911629848 Ser GCT t GCtc acaacacgac G - C T - A T - A G - C C - G G - C G - C T A T G C C C C A C C G A A | | | | | G T A C C G C G G G G C G | | | T T G A G G C C C C A G TGGCGTCAAGCCCC C - G T - A G - C G + T G - C T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |