Sequence ID | >W1911630074 |
Genome ID | PSYY01000001 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Haloferax sp. Atlit-4N [PSYY] |
Start position on genome | 313524 |
End posion on genome | 313451 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tcgtatgtgc |
tRNA gene sequence |
GGGACCGTGGGTTAGCCTGGTATACTTCGGGCCTTGGGTGCCCGTGACCCCGGTTCAAAT |
Downstream region at tRNA end position |
tttgtgcgaa |
Secondary structure (Cloverleaf model) | >W1911630074 Pro TGG c ACtc tttgtgcgaa G - C G - C G - C A - T C - G C - G G - C T A T G G G C C A C G A G | | | | | A C T T G G C C C G G C T | | + T T G T A C T G T A T TGAC C - G G - C G - C G - C C - G C T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |