Sequence ID | >W1911638495 |
Genome ID | PVWP01000005 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Aphanothece minutissima minutissima CCALA 015 [PVWP] |
Start position on genome | 7866 |
End posion on genome | 7938 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
ggcgatcgaa |
tRNA gene sequence |
GGGGAATTAGCTCAGCTGGTAGAGCGCTGCGATCGCACCGCAGAGGTCAGGGGTTCGAGT |
Downstream region at tRNA end position |
accattctcc |
Secondary structure (Cloverleaf model) | >W1911638495 Ala CGC a Atcc accattctcc G - C G - C G + T G - C A - T A - T T - A T G T T C C C C A C G A A | | | | | G T C T C G A G G G G C G | | | | T T G G A G C T A G AGGTC C - G T - A G - C C - G G - C A C T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |