Sequence ID | >W1911639013 |
Genome ID | PXOH01000044 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Aphanothece hegewaldii CCALA 016 [PXOH] |
Start position on genome | 6815 |
End posion on genome | 6901 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gaccctacta |
tRNA gene sequence |
GGAGAGATGGCCGAGCGGTTGAAGGCGCAGCACTGGAAATGCTGTTTAGGGGTAACTTTA |
Downstream region at tRNA end position |
tgaaagcgag |
Secondary structure (Cloverleaf model) | >W1911639013 Ser GGA a Gtaa tgaaagcgag G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A C G A G | | | | | G G G C C G G A G G G C G | | | T T T A G G C T G A G TTTAGGGGTAACTTTAAC C - G A - T G - C C - G A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |