Sequence ID | >W1911659818 |
Genome ID | QEZD01000080 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Xanthomonas vesicatoria BRIP62388 [QEZD] |
Start position on genome | 47863 |
End posion on genome | 47938 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
cgaagcacgt |
tRNA gene sequence |
GGGGCGGTAGCTCAGCTGGGAGAGCGTCGCGTTCGCATCGCGAAGGTCGAGGGTTCGATC |
Downstream region at tRNA end position |
tctttccgtc |
Secondary structure (Cloverleaf model) | >W1911659818 Ala CGC t ACCA tctttccgtc G - C G - C G + T G - C C - G G - C G - C C T T T T C C C A C G A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C G A G AGGTC T - A C - G G - C C - G G - C T T T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |